Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Glutamate tRNA (tRNA-Glu), predicted by tRNAscan-SE analysis secondary structure diagram

Saccharomyces cerevisiae S288C Glutamate tRNA (tRNA-Glu), predicted by tRNAscan-SE analysis URS000012840E_559292

Automated summary: This ncRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (Rfam, ENA, SGD). Described in 41 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C Glutamate tRNA (tRNA-Glu), predicted by tRNAscan-SE analysis sequence is a product of tRNA-Glu-TTC-2-1 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCGAUAUAGUGUAACGGCUAUCACAUCACGCUUUCACCGUGGAGACCGGGGUUCGACUCCCCGUAGCGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 0 other species

    1. Saccharomyces cerevisiae tRNA-Glu
    2D structure New