Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Burkholderia vietnamiensis G4 5S ribosomal RNA secondary structure diagram

Burkholderia vietnamiensis G4 5S ribosomal RNA URS0000125ED0_269482

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUGACCAUAGCGAGUCGGUCCCACCCCUUCCCAUCCCGAACAGGACCGUGAAACGACUCUACGCCGAUGAUAGUGCGGAUUCCCGUGUGAAAGUAGGUAAUCGUCAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Burkholderia ambifaria AMMD 5S ribosomal RNA
  2. Burkholderia cenocepacia 5S rRNA
  3. Burkholderia cenocepacia H111 5S ribosomal RNA
  4. Burkholderia orbicola MC0-3 5S ribosomal RNA
  5. Burkholderia cepacia 5S rRNA
  6. Burkholderia cepacia ATCC 25416 5S ribosomal RNA
  7. Burkholderia cepacia GG4 5S ribosomal RNA
  8. Burkholderia contaminans 5S ribosomal RNA
  9. Burkholderia diffusa ribosomal RNA 5s ribosomal RNA
  10. Burkholderia dolosa AU0158 5S ribosomal RNA
  11. Burkholderia multivorans 5S ribosomal RNA
  12. Burkholderia multivorans ATCC BAA-247 5S ribosomal RNA
  13. Burkholderia sp. MSHR3999 5S ribosomal RNA
  14. Burkholderia stabilis 5S ribosomal RNA
  15. Burkholderia ubonensis MSMB22 5S ribosomal RNA
  16. Burkholderia vietnamiensis 5S rRNA
  17. Burkholderia vietnamiensis LMG 10929 5S ribosomal RNA
  18. Clostridium sporogenes 5S ribosomal RNA
2D structure