Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Burkholderiaceae bacterium 5S ribosomal RNA secondary structure diagram

Burkholderiaceae bacterium 5S ribosomal RNA URS00001240D4_2030806

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGAUGACCAUAGCAAGUUGGUACCACUCCUUCCCAUCCCGAACAGGACAGUGAAACGACUUAGCGCCGAUGAUAGUGCGGAUUCCCGUGUGAAAGUAGGACAUCGUCAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Azonexus sp. 5S ribosomal RNA
  2. Bacteroidia bacterium 5S ribosomal RNA
  3. Polaromonas sp. 16-63-31 5S ribosomal RNA
  4. Polaromonas sp. 17-63-33 5S ribosomal RNA
  5. Polaromonas sp. 24-63-21 5S ribosomal RNA
  6. Polaromonas sp. 35-63-35 5S ribosomal RNA
  7. Polaromonas sp. 39-63-25 5S ribosomal RNA
  8. Polaromonas sp. CF318 5S ribosomal RNA
  9. Polaromonas sp. 5S ribosomal RNA
  10. Polaromonas sp. JS666 5S rRNA
  11. Polaromonas sp. OV174 5S rRNA. Bacterial TSU
  12. Polaromonas sp. P1(28)-8 5S ribosomal RNA
  13. Polaromonas sp. Pch-P 5S ribosomal RNA
  14. Polaromonas sp. SP1 5S ribosomal RNA
  15. Polaromonas sp. YR568 5S rRNA. Bacterial TSU
  16. Sulfurimonadaceae bacterium 5S ribosomal RNA
2D structure