Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-378d URS00001234DF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-378d: Hsa-mir-378d is a microRNA that has been studied in various contexts [PMC7047281]. However, the negative correlation of YY1 and hsa-mir-378d has not been reported in CRC [PMC7047281]. To the best of our knowledge, hsa-mir-378d and hsa-miR-26b-3p have been shown to correlate with rheumatoid arthritis development [PMC6855002]. Additionally, hsa-mir-378d has been found to correlate with the development of rheumatoid arthritis [PMC6855002]. In a study, hsa-mir-378d was identified as one of the miRNAs with significantly altered expression in a specific context [PMC10008540]. Another study suggested that hsa-mir-378d may be a potential biomarker for improving the diagnosis of colorectal cancer [PMC7985995]. Hsa-mir-378d has also been found to be targeted by hsa_circRNA_104484, along with other miRNAs [PMC8266806]. Furthermore, hsa-mir-378d has shown similar expression patterns as other miRNAs in relation to their target genes [PMC7047281]. It has also been found to regulate the expression of specific genes by inhibiting certain miRNAs [PMC8164409]. Hsa-mir-378d was measured as one of the differentially expressed miRNAs in a study using qRT-PCR [PMC7305552]. Additionally, it was included in custom oligonucleotide synthesis for microRNA primers [PMC5751259]. In another study, the expressions of various members of the hsa-mir-378 family were found to be decreased under long-term hypoxia conditions [PMC5751259].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGACUUGGAGUCAGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications