Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR1320-5p URS0000123143_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR1320-5p: Osa-mir1320-5p is a microRNA that has been found to be differentially expressed in rice upon infection with R. solani [PMC9189367]. To validate the expression of osa-mir1320-5p, qRT-PCR experiments were conducted, and the results showed that the expression trends were consistent with the data from small RNA-seq [PMC7037501]. In a study comparing the expression of miRNAs in rice shoots and roots, osa-mir1320-5p was found to exhibit an opposite expression pattern in these two tissues [PMC5249095]. Another study identified osa-mir1320-5p as one of the highly abundant miRNAs in rice root tips [PMC3734165]. Furthermore, qRT-PCR analysis confirmed significant changes in the expression of osa-mir1320-5p during infection with R. solani [PMC4257594]. In susceptible plants infected with rice stripe virus, osa-mir1320-5p was found to be upregulated [PMC5897953]. Additionally, osa-mir1320-5p was identified as a miRNA involved in rice immunity against M. oryzae and showed preferential expression under fungal-infected conditions in susceptible genotypes [PMC7662745]. Finally, osa-mir1320-5p was found to be preferentially expressed during R. solani infection in all six tested rice cultivars [PMC7662745].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAACGGAGGAAUUUUAUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group microRNA osa-miR1320-5p
Publications