Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR393b-5p URS0000120250_4577

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAAAGGGAUCGCAUUGAUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Amborella trichopoda atr-miR393
  2. Arabidopsis lyrata aly-miR393a-5p
  3. Arabidopsis thaliana ath-miR393b-5p
  4. Camelina sativa cas-miR393-5p
  5. Carica papaya cpa-miR393
  6. Glycine max gma-miR393f
  7. Helianthus tuberosus htu-miR393c
  8. Manihot esculenta mes-miR393b
  9. Solanum tuberosum stu-miR393-5p
  10. Theobroma cacao (cacao) tcc-miR393a
Publications