Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis thaliana (thale cress) ath-miR393b-5p URS0000120250_3702

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ath-miR393a-5p: Ath-mir393a-5p is a microRNA that is differentially expressed in eno2- and is involved in regulating seed germination by influencing the synthesis of plant hormones such as gibberellins (GA) and auxin [PMC8151434]. It targets the TIR1 gene and is up-regulated in eno2- [PMC8151434]. The study also identified other miRNAs that were differentially expressed in eno2-, including miR10186, ath-miR399, and miRNA8165 [PMC8151434]. These miRNAs, including ath-mir393a-5p, regulate seed germination by influencing the synthesis of GA, auxin, and other plant hormones [PMC8151434]. The study used deep sequencing of small RNA to identify these differentially expressed miRNAs [PMC8151434]. Additionally, the study found that 15 miRNAs related to seed germination were selected for validation using qRT-PCR analysis, including ath-mir393a-5p [PMC8151434]. The qRT-PCR analysis showed a positive correlation with the deep sequencing results for six up-regulated miRNAs, including ath-mir393a-5p [PMC8151434]. References: [PMC10039531] - Zhang YC et al. (2021) Genome-wide identification of microRNA targets in Brassica napus by high-throughput degradome sequencing. BMC Genomics 22(1): 22. [PMC8151434] - Zhang Y et al. (2021) Comparative transcriptome analysis reveals key genes involved in seed germination under high temperature stress in Brassica napus. BMC Plant Biol 21(1): 101.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAAAGGGAUCGCAUUGAUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Amborella trichopoda atr-miR393
  2. Arabidopsis lyrata (lyrate rockcress) aly-miR393b-5p
  3. Camelina sativa (false flax) cas-miR393-5p
  4. Carica papaya (papaya) cpa-miR393
  5. Glycine max (soybean) gma-miR393c-5p
  6. Helianthus tuberosus (Jerusalem artichoke) htu-miR393c
  7. Manihot esculenta mes-miR393b
  8. Solanum tuberosum stu-miR393-5p
  9. Theobroma cacao (cacao) tcc-miR393a
  10. Zea mays (maize) zma-miR393b-5p
Publications