Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Carica papaya (papaya) cpa-miR393 URS0000120250_3649

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAAAGGGAUCGCAUUGAUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Amborella trichopoda atr-miR393
  2. Arabidopsis lyrata (lyrate rockcress) aly-miR393b-5p
  3. Arabidopsis thaliana (thale cress) ath-miR393b-5p
  4. Camelina sativa (false flax) cas-miR393-5p
  5. Glycine max (soybean) gma-miR393c-5p
  6. Helianthus tuberosus (Jerusalem artichoke) htu-miR393c
  7. Manihot esculenta mes-miR393b
  8. Solanum tuberosum stu-miR393-5p
  9. Theobroma cacao (cacao) tcc-miR393a
  10. Zea mays (maize) zma-miR393b-5p
Publications