Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4689 URS000011A030_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4689: Hsa-mir-4689 is a miRNA that has been identified in various studies as being differentially expressed in different conditions and diseases. It has been found to be part of hub triple regulatory networks, along with other miRNAs and lncRNAs, in atherosclerosis and inflammatory bowel macrophage regulation [PMC9030878]. In the context of biliary atresia (BA), the expression levels of hsa-mir-4689 were found to be significantly higher in infants with BA compared to controls [PMC4754688]. Hsa-mir-4689, along with other miRNAs (hsa-miR-150-3p, hsa-miR-4429, and hsa-miR-92a-3p), may play important roles in the pathogenesis of BA by regulating their target genes [PMC4754688]. Hsa-mir-4689 has also been implicated in other conditions such as mesial temporal lobe epilepsy with hippocampal sclerosis [PMC8699332] and intracranial aneurysms [PMC8699332]. It has been predicted by multiple online platforms as being differentially expressed in various tissues including the brain [PMC8699332]. In a study on colorectal cancer, hsa-mir-4689 was found to be one of the six differently expressed miRNAs identified through screening methods [PMC7523764]. Overall, hsa-mir-4689 is a miRNA that shows differential expression across various diseases and conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGAGGAGACAUGGUGGGGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications