v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Medicago truncatula (barrel medic) mtr-miR396a-3p URS0000119847_3880

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUCAAGAAAGCUGUGGGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Citrus sinensis csi-miR396f-3p
  2. Glycine max gma-miR396b-3p
  3. Prunus persica (peach) microRNA miRNA_428
 Publications