Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cochliomyia hominivorax (primary screw-worm) mature cho-miR-184-5p URS00001195BE_115425

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUAUCAUUCUCUCGCCCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-184-5p
  2. Drosophila erecta der-miR-184-5p
  3. Drosophila grimshawi dgr-miR-184-5p
  4. Drosophila melanogaster dme-miR-184-5p
  5. Drosophila sechellia dse-miR-184-5p
  6. Drosophila simulans dsi-miR-184-5p
  7. Drosophila yakuba dya-miR-184-5p
Relationships New

Molecular Relationships