Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Dehalococcoides mccartyi BAV1 5S ribosomal RNA secondary structure diagram

Dehalococcoides mccartyi BAV1 5S ribosomal RNA URS0000117F57_216389

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUGGUUAGAGCGGGGUGGUACCACCCGUUCCCGUCCCGAACACGGUCGUGAAACGCCCCAGCGCAGACGAUACUUAGGAGGCAACUCCUUGUGGAAAAUAUGCCACUGCCCGGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Dehalococcoides mccartyi 5S rRNA
  2. Dehalococcoides mccartyi BTF08 5S ribosomal RNA
  3. Dehalococcoides mccartyi DCMB5 5S ribosomal RNA
  4. Dehalococcoides mccartyi GT 5S ribosomal RNA
  5. Dehalococcoides mccartyi GY50 5S ribosomal RNA
  6. Dehalococcoides mccartyi VS 5S ribosomal RNA
  7. Dehalococcoides sp. UCH007 5S ribosomal RNA
2D structure