5S ribosomal RNA from Escherichia coli (PDB 1ML5, chain b)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

5S ribosomal RNA from Escherichia coli (PDB 1ML5, chain b) URS00001170B4_562

123 nucleotides
1 database (PDBe)
Found in 2 other species
2 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAUCCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCCGAUGGUACUGGGCGGGCGACCGCCUGGGAGAGUAGGUCGGUGCGGGGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Thermus thermophilus HB8 5S ribosomal RNA from Thermus thermophilus HB8 (PDB 4V4X, chain BB)
Thermus thermophilus 5S ribosomal RNA from Thermus thermophilus (PDB 4V42, chain BB)

2D structure

Publications