Automated summary: This tRNA sequence is 106 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 2 databases (Rfam, SGD). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Found in the Saccharomyces cerevisiae S288C reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GAAGCGGUGGCUCAAUGGUAGAGCUUUCGACUCCAAUUAAAUCUUGGAAAUUCCACGGAAUAAGAUUGCAAUCGAAGGGUUGCAGGUUCAAUUCCUGUCCGUUUCA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.