v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Trp secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Trp URS0000116720_559292

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAAGCGGUGGCUCAAUGGUAGAGCUUUCGACUCCAAUUAAAUCUUGGAAAUUCCACGGAAUAAGAUUGCAAUCGAAGGGUUGCAGGUUCAAUUCCUGUCCGUUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Fusarium falciforme tRNA-Trp
  2. Saccharomyces cerevisiae AWRI796 tRNA
  3. Saccharomyces cerevisiae (baker's yeast) tRNA-Trp gene, anticodon, cca, potential intron between positions 12453 12420, len: 106
  4. Saccharomyces cerevisiae EC1118 tRNA-Trp
  5. Saccharomyces cerevisiae FostersB tRNA
  6. Saccharomyces cerevisiae FostersO tRNA
  7. Saccharomyces cerevisiae Lalvin QA23 tRNA
  8. Saccharomyces cerevisiae P301 tRNA-Trp
  9. Saccharomyces cerevisiae R008 tRNA-Trp
  10. Saccharomyces cerevisiae R103 tRNA-Trp
  11. Saccharomyces cerevisiae RM11-1a tRNA-Trp
  12. Saccharomyces cerevisiae Vin13 tRNA
  13. Saccharomyces cerevisiae VL3 tRNA
  14. Saccharomyces pastorianus tRNA-Trp
 2D structure Publications