Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
U4 snRNA from Saccharomyces cerevisiae (PDB 5NRL, chain 4) secondary structure diagram

U4 snRNA from Saccharomyces cerevisiae (PDB 5NRL, chain 4) URS00001143F5_4932

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCCUUAUGCACGGGAAAUACGCAUAUCAGUGAGGAUUCGUCCGAGAUUGUGUUUUUGCUGGUUGAAAUUUAAUUAUAAACCAGACCGUCUCCUCAUGGUCAAUUCGGUGUUCGCUUUUGAAUACUUCAAGACUAUGUAGGGAAUUUUUGGAAUACCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 114 other species

  1. Saccharomyces cerevisiae EC1118 SNR14
  2. Saccharomyces cerevisiae Kyokai no. 7 K7_snR14
  3. Saccharomyces cerevisiae P283 SNR14
  4. Saccharomyces cerevisiae P301 SNR14
  5. Saccharomyces cerevisiae PE-2 SNR14
  6. Saccharomyces cerevisiae R008 SNR14
  7. Saccharomyces cerevisiae R103 SNR14
  8. Saccharomyces cerevisiae S288C Small Nuclear RNA
  9. Saccharomyces cerevisiae YJM1129 SNR14
  10. Saccharomyces cerevisiae YJM1133 SNR14
  11. Saccharomyces cerevisiae YJM1190 SNR14
  12. Saccharomyces cerevisiae YJM1208 SNR14
  13. Saccharomyces cerevisiae YJM1242 SNR14
  14. Saccharomyces cerevisiae YJM1244 SNR14
  15. Saccharomyces cerevisiae YJM1250 SNR14
  16. Saccharomyces cerevisiae YJM1273 SNR14
  17. Saccharomyces cerevisiae YJM1304 SNR14
  18. Saccharomyces cerevisiae YJM1332 SNR14
  19. Saccharomyces cerevisiae YJM1336 SNR14
  20. Saccharomyces cerevisiae YJM1338 SNR14
  21. Saccharomyces cerevisiae YJM1341 SNR14
  22. Saccharomyces cerevisiae YJM1356 SNR14
  23. Saccharomyces cerevisiae YJM1383 SNR14
  24. Saccharomyces cerevisiae YJM1386 SNR14
  25. Saccharomyces cerevisiae YJM1387 SNR14
  26. Saccharomyces cerevisiae YJM1399 SNR14
  27. Saccharomyces cerevisiae YJM1415 SNR14
  28. Saccharomyces cerevisiae YJM1417 SNR14
  29. Saccharomyces cerevisiae YJM1419 SNR14
  30. Saccharomyces cerevisiae YJM1434 SNR14
  31. Saccharomyces cerevisiae YJM1443 SNR14
  32. Saccharomyces cerevisiae YJM1447 SNR14
  33. Saccharomyces cerevisiae YJM1450 SNR14
  34. Saccharomyces cerevisiae YJM1477 SNR14
  35. Saccharomyces cerevisiae YJM1526 SNR14
  36. Saccharomyces cerevisiae YJM1527 SNR14
  37. Saccharomyces cerevisiae YJM1574 SNR14
  38. Saccharomyces cerevisiae YJM189 SNR14
  39. Saccharomyces cerevisiae YJM244 SNR14
  40. Saccharomyces cerevisiae YJM248 SNR14
  41. Saccharomyces cerevisiae YJM270 SNR14
  42. Saccharomyces cerevisiae YJM320 SNR14
  43. Saccharomyces cerevisiae YJM450 SNR14
  44. Saccharomyces cerevisiae YJM453 SNR14
  45. Saccharomyces cerevisiae YJM456 SNR14
  46. Saccharomyces cerevisiae YJM555 SNR14
  47. Saccharomyces cerevisiae YJM681 SNR14
  48. Saccharomyces cerevisiae YJM969 SNR14
  49. Saccharomyces cerevisiae YJM972 SNR14
  50. Saccharomyces cerevisiae YJM975 SNR14
  51. Saccharomyces cerevisiae YJM978 SNR14
  52. Saccharomyces cerevisiae YJM981 SNR14
  53. Saccharomyces cerevisiae YJM984 SNR14
  54. Saccharomyces cerevisiae YJM987 SNR14
  55. Saccharomyces cerevisiae YJM990 SNR14
  56. Saccharomyces cerevisiae YJM993 SNR14
  57. Saccharomyces cerevisiae YJM996 SNR14
2D structure Publications