Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-148b-5p URS0000113EBB_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAGUUCUGUUAUACACUCAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Cavia porcellus cpo-miR-148b-5p
  2. Cervus elaphus cel-miR-148b-5p
  3. Dasypus novemcinctus (nine-banded armadillo) dno-miR-148b-5p
  4. Macaca mulatta (Rhesus monkey) mml-miR-148b-5p
  5. Oryctolagus cuniculus ocu-miR-148b-5p
  6. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-3354681
Publications