tRNA(Phe) from None (PDB 1JGQ, chain B)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

tRNA(Phe) from None (PDB 1JGQ, chain B) URS000011107D_32630

76 nucleotides
1 database (PDBe)
Found in 8 other species
8 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Escherichia coli A/T-site tRNA Phe from Escherichia coli (PDB 4V69, chain AY)
Saccharomyces cerevisiae fMet-Phe-tRNA(Phe) from Saccharomyces cerevisiae (PDB 6XZB, chain g2)
Thermomyces lanuginosus P/E tRNA from Thermomyces lanuginosus (PDB 4V7H, chain A7)
Saccharomyces PHENYLALANINE TRANSFER RNA from Saccharomyces (PDB 1EVV, chain A)
Saccharomyces cerevisiae S288C Transfer RNA - Phe from Saccharomyces cerevisiae S288C (PDB 6GQ1, chain AX)
Bos taurus tRNA-Phe from Bos taurus (PDB 3IZY, chain N)
Thermus thermophilus TRNA(PHE) from Thermus thermophilus (PDB 4V42, chain AB)
Thermus thermophilus HB8 tRNA Phe (unmodified bases) from Thermus thermophilus HB8 (PDB 4V4P, chain BC)

2D structure

Publications