Automated summary: This pre miRNA sequence is 59 nucleotides long and is found in Caenorhabditis elegans. Annotated by 4 databases (RefSeq, miRBase, ENA, WormBase). Described in 4 papers. Caenorhabditis elegans microRNA cel-mir-4923b precursor sequence is a product of mir-4923b precursor, microRNA mir-4923.2, pre-microRNA mir-4923.2, mir-4923.2, cel-mir-4923b precursor, mir-4923b precurso, mir-4923b genes. Found in the Caenorhabditis elegans reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GUAAGCAAAUUCCCGUCAUUUUCUGGAAAUAUUUUGAAACGGCGGCAAUUUGUUUACAG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.