Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila virilis dvi-miR-9c-5p URS000010CD08_7244

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUUGGUAUUCUAGCUGUAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-9c-5p
  2. Anopheles gambiae aga-miR-9c
  3. Bactrocera dorsalis (oriental fruit fly) bdo-miR-9c
  4. Cochliomyia hominivorax mature cho-miR-9c
  5. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-9c
  6. Culex quinquefasciatus cqu-miR-9-5p
  7. Drosophila ananassae dan-miR-9c
  8. Drosophila erecta der-miR-9c
  9. Drosophila grimshawi dgr-miR-9c
  10. Drosophila melanogaster dme-miR-9c-5p
  11. Drosophila mojavensis dmo-miR-9c
  12. Drosophila persimilis dpe-miR-9c
  13. Drosophila pseudoobscura dps-miR-9c
  14. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294469_df_nrg
  15. Drosophila sechellia dse-miR-9c
  16. Drosophila simulans Dsi-Mir-9-P11_5p (mature (guide))
  17. Drosophila willistoni dwi-miR-9c
  18. Drosophila yakuba dya-miR-9c