Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Solanum tuberosum (potato) stu-miR166c-5p URS0000108B6F_4113

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAAUGUUGUUUGGCUCGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Arabidopsis lyrata aly-miR166g-5p
  2. Camelina sativa cas-miR166f-5p
  3. Corchorus olitorius aly-miR166a-
  4. Cynara cardunculus var. scolymus cca-miR166i
  5. Glycine max gma-miR166h-5p
Publications