v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) colon cancer associated transcript 2 (CCAT2) URS000010576B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CCAT2: CCAT2 is a long non-coding RNA that has been studied in various types of cancer, including bladder cancer, osteosarcoma, and cervical cancer. In bladder cancer, CCAT2 has been found to promote tumor progression and is associated with higher TMN stage and histological grade [PMC5045372]. It has also been shown to increase cell migration in bladder cancer [PMC5045372]. In osteosarcoma, CCAT2 is overexpressed and promotes cell proliferation, invasion, and epithelial-mesenchymal transition (EMT) [PMC5908115]. It is also a downstream target of the Wnt signaling pathway [PMC5908115]. In cervical cancer, CCAT2 overexpression is associated with poor prognosis and promotes cell proliferation through the Wnt pathway [PMC4801156]. Additionally, CCAT2 has been found to regulate autophagy in hepatocellular carcinoma (HCC) and enhance invasion and metastasis through miR-4496 and ELAVL1 [PMC8435435]. Overall, CCAT2 plays an oncogenic role in various cancers by regulating key cellular processes such as proliferation, migration, EMT, autophagy, and Wnt signaling. It may serve as a potential therapeutic target for intervention in these cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCGAGGUGAUCAGGUGGACUUUCCUGGAUGUUCUGGGUCUUGACCUGAUUGCUGAAAAAUGAAUACAAAUUCAGAGAAGAAGAAAGCUAGUAUGAGACUACCAAAUGAUCAUCAGACAUUUCUUGAACACCAAUUAAAUUGCUAGGUAUGCUAAAGUUUGCAAAACUGGUAUAGACACCAAGAGGGAGGUAUCAACAGAGACUCCCCAAGAGCUAAGAGGAAACCACCUUGGACUGGAAGUCAAGAGCCAAAAUUCUAGACUCUACUCUGUAAUUAACUACCUAUUUGAAUUUGGAAAAAUCACCAUCAACUUUCCCAGCCUCGUUCUCUGCAUCUGGGAAAUGAAGGCGUCGUCCAAAUGAUUACAAGCUUCUUUUCCUGCUCUUAUUGCAUGAUUCCACUUCCACAGCCCUCCAGCAUUUUUUAGCAGCUGCAUCGCUCCAUAGAGCCUGCAGAGGGCACUAGACUGGGAAUUAGAAAACCUGAUUUCCCUUCCAGCUCCACCUCUGACCAAUUGCCUGACCCUGGUCAAAUUGCUUAACCUCUUCCUAUCUCAGCUCCCUAUCCAUAAAACAGAGGGACGAAUAAACUCUCCUCCUACCACUAAGAGGUGUAGCCAGAGUUAAUACCCUCAUCGUCCUUUGAGCUCAGCAGAUGAAAGGCACUGAGAAAAGUACAAAGAAUUUUUAUGUGCUAUUGACUUUAUUUUAUUUUAUGUGGGGGAGGGAGCCGGCCCCAGCUGGAAAGCUGCUUUCUCUGAAUCAAAGGGCAGGAACCCAGCAAGUUUCUCAGGAUUGGGGCCUUAGACUGGGCUGUGUAUACAGACAGUGCCAGCCAACCCCACAGUUCAGUUUCCUUUAACCUGGUGCUCCAGGCAAUAACUGUGCAACUCUGCAAUUUAACAAUGUGUUCUUUGUCCCACAACUGUUCUCGUUUCUCAACUGCCCAGGUAAUAUGUUUGGGCCUGUAGGAAGAGUCAAAUAGUUAAUAAGGGAAGGGUUUGGCAUGCCCUACGUAAGUUCUACCAGCAAGUCCCAACAAGAAGGCAUUCUGUGUCUCCUGAUUCCUGACCUACCCCCAAAAUGUACAAAUGUACAAGGAAUGAGCCCACUUUCCCAGCAGGCUGUAAUACCAGUUUGGCCUAUAUCAAUGCAUUGGUGAGCUGUGUUUUGUUUAUGGUUUUAUGCCAUCUAUUUUCCCAUGGAUAUUAUGUUUUCUAAAGAGCCCUUAAGUUUACGUCAGCUUUUAAAGCUACCAGCAGCACCAUUUCAGUUCAUAUUAAGCCCUUAAUAUGGUAUGAAUAGGAGAGCUAUUAGACUAAAGAGCCAUAAUCAUCCCUGAGGAAAACAUCCAUCACCAACAUUUAUGUGGUCCCUGAACUUCUAAAAGGUGUCAUCUCUCUGGGGUGUAUCUGGUGAGAGCUUUCUCUGGGAGAUGCCAAAAAGCCAAUGCAUUAGAUGAAGCUUAGAAGGGCAUUUUCUAACCAUUACAAAUUGCCUAGUCUAGCAUCUCAAUUUCAUCUACGUGAAGAGCCUUAAUUAAAUUUGUUGGGGUUUGAUCCUUUAUCCCCAGAUGUGGCGCUGACAGAGAUUGCUUACAUAAAUAAUGUGUGCUCCAAGUGCUUGCCAGGCUCCUGGCUCAGCUGGGACAGCUGUAGCUUUUUGAAUGUCAUUCCCAAGAUAUCCUGCAGGUGUUCAGCUUCCCCUGUUCUACUCUGGGAAGAGAGCCGUGGGCAACAUCAGCCCAGAAGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications