Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Hordeum vulgare (barley) hvu-miR168-5p URS000010419E_4513

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hvu-miR168-5p: hvu-mir168-5p is a specific type of miRNA that has been studied in various conditions such as water and drought conditions, salinity stress, and transgenic barley. In water and drought conditions, hvu-mir168-5p did not show a significant change in expression level [PMC4309496]. However, under drought conditions, hvu-mir168-5p was up-regulated in leaves [PMC4309496]. Under salinity stress, hvu-mir168-5p was down-regulated along with hvu-miR5048a and hvu-miR444b, while hvu-miR171-5p and hvu-miR6213 were up-regulated [PMC4570814]. In terms of drought tolerance, the expression of hvu-miR156a/b was upregulated in Rolap and Yousef but not in Morocco 9-75. On the other hand, hvu-mir168-5p and hvu-miR159a/b were downregulated in Rolap and Morocco 9-75 but not in Yousef [PMC10025483]. In transgenic barley, the abundance of miRNAs varied with 52.4% of total reads accounted for by hvu-miR156a/b and 71.3% accounted for by hvu-mir168-5p [PMC3409865]. However, there is a possibility that the annotated sequence for hvu-miR168-3p might be incorrect based on its secondary structure [PMC3409865]. Overall, these studies provide insights into the expression patterns of miRNAs such as hvu-mir168-5p under different stress conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGCUUGGUGCAGAUCGGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Aegilops tauschii ata-miR168-5p
  2. Brachypodium distachyon (stiff brome) bdi-miR168-5p
  3. Oryza sativa (Asian cultivated rice) osa-miR168a-5p
  4. Oryza sativa Japonica Group microRNA osa-miR168a-5p
  5. Saccharum officinarum (sugarcane) sof-miR168a
  6. Saccharum sp. ssp-miR168a
  7. Sorghum bicolor sbi-miR168
  8. Zea mays (maize) zma-miR168a-5p
Publications