Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-190b URS00000FFE5F_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUAUGUUUGAUAUUGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bos taurus (cattle) bta-miR-190b
  2. Equus caballus eca-miR-190b
  3. Homo sapiens hsa-miR-190
  4. Macaca mulatta mml-miR-190b
  5. Monodelphis domestica mdo-miR-190b
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49482581
  7. Pan troglodytes (chimpanzee) ptr-miR-190b
  8. Pongo pygmaeus ppy-miR-190b
  9. Tupaia chinensis (Chinese tree shrew) tch-miR-190b
Publications