Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila yakuba microRNA dya-mir-307 precursor secondary structure diagram

Drosophila yakuba microRNA dya-mir-307 precursor URS00000FFDD9_7245

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCUUGCUUUGACUCACUCAACCUGGGUGUGAUGUUAUUUCGAUAUGGUAUCCAUCACAACCUCCUUGAGUGAGCGAUAGCAGGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Drosophila ananassae microRNA dan-mir-307 precursor
  2. Drosophila erecta microRNA der-mir-307 precursor
  3. Drosophila melanogaster microRNA dme-mir-307a precursor
  4. Drosophila sechellia microRNA dse-mir-307 precursor
  5. Drosophila simulans microRNA dsi-mir-307 precursor
2D structure