Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Fibrobacter succinogenes 5S rRNA secondary structure diagram

Fibrobacter succinogenes 5S rRNA URS00000FD662_833

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAGCGGUUAUCGAGUGAGGGUCACACCCGUUCCCAUCCCGAACACGGAAGUUAAGCCUCAGAUCGCCGAUGGUACCUGGCCCUCGGGUCCGGGAGAGUAGGUCGCCGCUGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Alphaproteobacteria bacterium 5S ribosomal RNA
  2. Fibrobacter sp. UWB4 5S ribosomal RNA
  3. Fibrobacter succinogenes subsp. succinogenes S85 5S ribosomal RNA
2D structure