Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-1662 URS00000FC42C_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-1662: gga-mir-1662 is a differentially expressed miRNA that has been studied in relation to immune responses in chicken. It has been found to interact with TLR1LA, which is important in responding to SE infection [PMC5237128]. Following AIV infection, gga-mir-1662 was significantly up-regulated in chicken lung [PMC5237128]. Further research is needed to confirm the function of the interaction between gga-mir-1662 and TLR1LA [PMC5237128]. In the current study, gga-mir-1662 was down-regulated while its target gene TLR1LA was up-regulated in response to SE infection [PMC5237128]. Additionally, gga-miR-34a-5p and gga-miR-1416-5p were found to play important roles in SE infection through regulating their target genes [PMC5237128]. In a study comparing different miRNAs, including gga-mir-1662, it was observed that miRNAs in group one showed higher expression in the N group but lower expression in the I group [PMC5237128]. Several miRNAs have been identified as regulators of innate immune responses induced by S. Enteritidis, including gga-miR-155 and gga-miR-34a-5p [PMC8242174]. In relation to FAdV-4 infection, it has been reported that gga-mir-1662 affects immune responses by targeting IL24 and is differentially expressed at 120 min after infection [PMC7248314]. Overall, studies have shown that gga-mir-1662 and other miRNAs play important roles in SE infection by regulating their target genes [PMC6628503] [PMC6554294]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGACAUCAUCAUACUUGGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

Publications