Solanum tuberosum (potato) stu-miR164-5p URS00000FBCC2_4113

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 22 other species
• 1079 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGGAGAAGCAGGGCACAUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

1. Ananas comosus (pineapple) microRNA 164f
2. Fragaria vesca subsp. vesca fve-miR164c
3. Manihot esculenta mes-miR164d
4. Medicago truncatula (barrel medic) mtr-miR164d
5. Nicotiana tabacum nta-miR164c
6. Populus tomentosa Pto-miR164f
7. Populus trichocarpa (black cottonwood) ptc-miR164f
8. Prunus persica ppe-miR164d
9. Ricinus communis rco-miR164d
10. Theobroma cacao (cacao) tcc-miR164c
11. Vitis vinifera (wine grape) vvi-miR164b

Publications Download

• FASTA
• JSON