v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-1307_3p (mature (guide)) URS00000F8038_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1307: In a study by Li et al., it was found that the opposite-arm miRNA of hsa-mir-1307 had a higher expression level compared to the annotated one in most libraries, except for SRX018968 and SRX018971 [PMC3521178]. Furthermore, Li et al. validated the expression of four differentially expressed miRNAs, including hsa-miR-17*, hsa-miR-7, hsa-mir-1307, and hsa-miR-663, through Q-PCR analysis [PMC5352919].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUCGGCGUGGCGUCGGUCGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Capra hircus chi-miR-1307-3p
  2. Cervus elaphus (red deer) cel-miR-1307
  3. Dasypus novemcinctus dno-miR-1307-3p
  4. Daubentonia madagascariensis (aye-aye) dma-miR-1307
  5. Macaca mulatta (Rhesus monkey) Mml-Mir-1307_3p (mature (co-guide))
  6. Oryctolagus cuniculus ocu-miR-1307-3p
  7. Papio hamadryas (hamadryas baboon) pha-miR-1307
 Publications