v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila sechellia tRNA-Val (CAC) (tRNA-Val-CAC-1-1) secondary structure diagram

Drosophila sechellia tRNA-Val (CAC) (tRNA-Val-CAC-1-1) URS00000F616D_7238

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUUUCGUAGUGUAGUGGUUAUCACGUGUGCUUCACACGCACAAGGUCCCCGGUUCGAACCCGGGCGAAAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Drosophila erecta tRNA-Val (CAC) (tRNA-Val-CAC-1-1)
  2. Drosophila mauritiana (Fruit fly) tRNA-Val
  3. Drosophila melanogaster (fruit fly) transfer RNA:Valine-CAC 1-1 (Dmel_CR31572)
  4. Drosophila santomea (Fruit fly) tRNA-Val
  5. Drosophila simulans tRNA-Val (CAC) (tRNA-Val-CAC-1-1)
  6. Drosophila teissieri (Fruit fly) tRNA-Val
  7. Drosophila yakuba tRNA-Val (CAC) (tRNA-Val-CAC-1-1, tRNA-Val-CAC-1-2)
  8. Stomoxys calcitrans tRNA-Val
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications