Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca nemestrina (Pig-tailed macaque) mne-mir-197 (ENSMNEG00000011353.1) URS00000F4AC3_9545

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUCACCCUUCACCACCUUCUCCACCCAGCAUGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 79 other species

  1. Ailuropoda melanoleuca microRNA mir-197
  2. Aotus nancymaae (Ma's night monkey) microRNA 197 (ENSANAG00000003140.1)
  3. Ateles geoffroyi microRNA age-mir-197 precursor
  4. Callithrix jacchus microRNA mir-197
  5. Canis lupus familiaris microRNA mir-197
  6. Cavia porcellus (Domestic guinea pig) microRNA mir-197
  7. Cebus imitator microRNA 197 (ENSCCAG00000005871.1)
  8. Cercocebus atys (Sooty mangabey) microRNA 197 (ENSCATG00000010166.1)
  9. Chlorocebus sabaeus microRNA 197 (ENSCSAG00000027418.1)
  10. Colobus angolensis palliatus miRNA (ENSCANG00000008210.1)
  11. Dipodomys ordii microRNA mir-197
  12. Equus asinus asinus (donkey) miRNA (ENSEASG00005003016.1)
  13. Equus asinus (ass) microRNA 197 (ENSEASG00005003016.2)
  14. Equus caballus microRNA eca-mir-197 precursor
  15. Felis catus microRNA 197 (ENSFCAG00000016509.3)
  16. Fukomys damarensis (Damara mole-rat) microRNA mir-197
  17. Gorilla gorilla gorilla microRNA 197 (ENSGGOG00000041555.1)
  18. Gorilla gorilla (western gorilla) microRNA mir-197
  19. Heterocephalus glaber microRNA mir-197
  20. Homo sapiens microRNA hsa-mir-197 precursor
  21. Lynx canadensis (Canada lynx) microRNA 197 (ENSLCNG00005014376.1)
  22. Macaca mulatta microRNA mml-mir-197 precursor
  23. Mandrillus leucophaeus (Drill) microRNA 197 (ENSMLEG00000005171.1)
  24. Microcebus murinus (gray mouse lemur) microRNA 197 (ENSMICG00000018023.3)
  25. Mustela putorius furo miRNA (ENSMPUG00000021421.1)
  26. Nomascus leucogenys microRNA 197 (ENSNLEG00000022265.2)
  27. Otolemur garnettii microRNA 197 (ENSOGAG00000018459.2)
  28. Pan paniscus microRNA ppa-mir-197 precursor
  29. Panthera leo microRNA 197 (ENSPLOG00000006482.1)
  30. Panthera pardus (leopard) microRNA 197 (ENSPPRG00000013967.1)
  31. Panthera tigris altaica (Tiger) microRNA 197 (ENSPTIG00000002677.1)
  32. Pan troglodytes microRNA ptr-mir-197 precursor
  33. Papio anubis microRNA mir-197
  34. Pongo abelii (Sumatran orangutan) microRNA mir-197
  35. Pongo pygmaeus microRNA ppy-mir-197 precursor
  36. Propithecus coquereli microRNA 197 (ENSPCOG00000011865.1)
  37. Rhinopithecus bieti microRNA 197 (ENSRBIG00000008109.1)
  38. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 197 (ENSRROG00000027211.1)
  39. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 197 (ENSSBOG00000019454.1)
  40. Sciurus vulgaris (Eurasian red squirrel) microRNA 197 (ENSSVLG00005012919.1)
  41. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015001604.1)