Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294471_df_nrg URS00000F3F84_46245

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGGUACUUAGUGACUCUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-306
  2. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-306
  3. Drosophila ananassae dan-miR-306
  4. Drosophila erecta der-miR-306-5p
  5. Drosophila grimshawi dgr-miR-306
  6. Drosophila melanogaster (fruit fly) dme-miR-306-5p
  7. Drosophila mojavensis dmo-miR-306-5p
  8. Drosophila persimilis dpe-miR-306
  9. Drosophila pseudoobscura dps-miR-306
  10. Drosophila sechellia dse-miR-306-5p
  11. Drosophila simulans Dsi-Mir-306_5p (mature (guide))
  12. Drosophila willistoni dwi-miR-306
  13. Drosophila yakuba dya-miR-306-5p