Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Thr (anticodon TGT) 5-1 (TRT-TGT5-1) secondary structure diagram

Homo sapiens (human) tRNA-Thr (anticodon TGT) 5-1 (TRT-TGT5-1) URS00000F30A4_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCCUAUAGCUCAGGGGUUAGAGCACUGGUCUUGUAAACCAGGGGUCGCGAGUUCAAAUCUCGCUGGGGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 93 other species

  1. Ailuropoda melanoleuca tRNA-Thr (TGT) (tRNA-Thr-TGT-5-1)
  2. Balaenoptera acutorostrata scammoni tRNA-Thr (TGT) (tRNA-Thr-TGT-5-1)
  3. Bos taurus tRNA-Thr (TGT) (tRNA-Thr-TGT-5-1)
  4. Callithrix jacchus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  5. Camelus ferus (Wild Bactrian camel) tRNA
  6. Carlito syrichta tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  7. Cavia porcellus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  8. Ceratotherium simum simum tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1)
  9. Chlorocebus sabaeus tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1)
  10. Choloepus hoffmanni tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1, tRNA-Thr-TGT-4-2)
  11. Cricetulus griseus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  12. Dasypus novemcinctus tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1)
  13. Dipodomys ordii tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1)
  14. Echinops telfairi tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  15. Eptesicus nilssonii tRNA-Thr
  16. Equus caballus tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1)
  17. Erinaceus europaeus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  18. Eschrichtius robustus tRNA-Thr
  19. Felis catus tRNA-Thr (TGT) (tRNA-Thr-TGT-7-1)
  20. Fukomys damarensis (Damara mole-rat) tRNA
  21. Gorilla gorilla gorilla tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  22. Heterocephalus glaber tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1)
  23. Ictidomys tridecemlineatus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  24. Loxodonta africana tRNA-Thr (TGT) (tRNA-Thr-TGT-10-1)
  25. Macaca mulatta tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  26. Marmota monax (woodchuck) tRNA.Thr
  27. Mesocricetus auratus (golden hamster) tRNA
  28. Microcebus murinus tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1)
  29. Mus caroli tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  30. Mus musculus castaneus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  31. Mus musculus domesticus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  32. Mus musculus musculus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  33. Mus musculus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1, tRNA-Thr-TGT-3-1)
  34. Mus pahari tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  35. Mus spretus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  36. Mustela putorius furo tRNA-Thr (TGT) (tRNA-Thr-TGT-5-1)
  37. Myotis brandtii tRNA
  38. Myotis davidii tRNA
  39. Myotis lucifugus tRNA-Thr (TGT) (tRNA-Thr-TGT-3 1 to 3)
  40. Nomascus leucogenys tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  41. Ochotona princeps tRNA-Thr (TGT) (tRNA-Thr-TGT-5-1)
  42. Oryctolagus cuniculus tRNA-Thr (TGT) (tRNA-Thr-TGT-6-1)
  43. Otolemur garnettii tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  44. Pan troglodytes tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  45. Papio anubis tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  46. Pongo abelii tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  47. Procavia capensis tRNA-Thr (TGT) (tRNA-Thr-TGT-6-1)
  48. Pteropus alecto tRNA
  49. Rattus norvegicus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  50. Saimiri boliviensis boliviensis tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  51. Sorex araneus tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1)
  52. Sus scrofa tRNA-Thr (TGT) (tRNA-Thr-TGT-5-1)
  53. Trichechus manatus latirostris tRNA-Thr (TGT) (tRNA-Thr-TGT-6-1)
  54. Tupaia chinensis (Chinese tree shrew) tRNA
  55. Tursiops truncatus tRNA-Thr (TGT) (tRNA-Thr-TGT-4-1)
2D structure Publications