Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Eptesicus fuscus (big brown bat) efu-miR-424 URS00000F0F49_29078

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCAGCAAUUCAUGUUUUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Bos taurus (cattle) Bta-Mir-15-P1c_5p (mature (guide))
  2. Canis lupus familiaris (dog) Cfa-Mir-15-P1c_5p (mature (guide))
  3. Cavia porcellus cpo-miR-424-5p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-424-5p
  5. Equus caballus (horse) eca-miR-424
  6. Homo sapiens (human) hsa-miR-424-5p
  7. Macaca mulatta mml-miR-424-5p
  8. Mus musculus Mus_musculus piRNA piR-mmu-49665523
  9. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-424
  10. Oryctolagus cuniculus ocu-miR-424-5p
  11. Pan paniscus (pygmy chimpanzee) ppa-miR-424
  12. Pan troglodytes (chimpanzee) ptr-miR-424
  13. Pongo pygmaeus ppy-miR-424
  14. Saimiri boliviensis boliviensis sbo-miR-424
  15. Sus scrofa ssc-miR-424-5p
Publications