Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-34a-3p URS00000EED18_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-34a: Hsa-mir-34a is a mature miRNA that can be assayed using the specific TaqMan Assay hsa-mir-34a [PMC8227962]. In the context of schizophrenia, the expression of hsa-mir-34a in brain regions BA46 and the caudate putamen did not show significant changes, which is consistent with a previous study [PMC5068884]. However, an earlier study reported upregulation of miR-34a in BA46 of individuals with schizophrenia, but this discrepancy may be due to differences in statistical approaches [PMC5068884]. In Alzheimer's disease (AD), hsa-mir-34a was found to be overexpressed in specific brain regions but downregulated in blood or cerebrospinal fluid [PMC10064073]. Low expression levels of hsa-mir-34a were significantly correlated with a low survival rate for patients with breast cancer [PMC7859909]. Downregulation of hsa-mir-34a, along with other miRNAs, has been associated with poor event-free survival and overall survival in cancer patients [PMC3235419]. In non-Hodgkin's lymphomas, reduced expression of p53-regulated oncosuppressive microRNAs such as hsa-miR-203 has been observed and may be induced by epigenetic mechanisms [PMC9408007]. Co-expression of hsa-mir-34a and interleukin-24 (IL-24) has been shown to enhance anti-tumor activity compared to their individual expression in oncolytic adenovirus therapy [PMC9502615]. Hsa-mir-34a mimic or hairpin inhibitor can be used for transfection experiments using appropriate transfection reagents [PMC7352675]. Hsa-miR-34a stable cells exhibited low levels of MMP2 expression [PMC7859909].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAUCAGCAAGUAUACUGCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications