v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2555 (LINC02555) URS00000ED9FC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02555: LINC02555 is a long non-coding RNA (lncRNA) that has been implicated in various biological processes and diseases. It has been suggested that LINC02555 may affect the expression or translation of LRRK2 mRNA in specific cells, leading to alterations in LRRK2 protein levels [PMC9274527]. In a study on lung adenocarcinoma (LUAD) patients, the expression levels of LINC02555 were found to be decreased [PMC8928224]. Additionally, LINC02555 was identified as one of the five PRlncRNAs that could be used to establish a signature for LUAD patient risk prediction [PMC9229145]. Interestingly, the expression level of LINC02555 was found to be higher in normal lung tissues, suggesting a potential repressive role in tumor growth or progression [PMC8965709]. In another study on patients with laryngeal squamous cell carcinoma (LSCC), it was observed that higher expression levels of LINC02555 were associated with poorer overall survival [PMC8082628]. These findings highlight the potential role of LINC02555 as a biomarker and therapeutic target for various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUUGUUGUUUUAUUUUGUUUGCUAUAAAGAUUAGCCUCUUGUUCAAUGGAAAAUAUGAUCAAAAACAGUGUUCAAAAAUUAUUUAAGGGCCCCAUCACUACAGCAAUCAUUAGUCCUACUGUGUAUGAAAUUUCUAAGUAUUUCUAAAUGCUCAACCCUAGACAUGCCCUUCACUGAUAUUUUUAAUGUGCUUUCAGUACCUUGGCCAUUUAAUAACUUAUGUUCUUUUUUCAAAAUCUUAGGAAGAAAUUGUGUUUUGGAAUUGGGCCAACAGUAUGUGUUUCUCCGGUGGAUAAGCAAAAUUUCAUAAGAACAAAGAUGAUUCAAGCAGAUGUUUAUCAUGAAACUGCCAUAAAAAGCACCCGAAGUCACAAAGAUAAACAUCAAAUCCAGUCCUUGGAAAUUUCCCCCACCCUACCUGAGCAUCUUUUGAAGUAGAUAUUCAAUUAUUUUGAAGGAUUUUUAAAGAAUUUUCUAGAUUUCAUCUAAAAGACACUUUUGAAAUCUGCGUUAAAAUUCAUGGAAAUAUAUCCUAGAUGAAUUUGGAGGAAUGUAAGCAAGUAGGUACAAACCUUUAUUUUAUCCCUCAGUGACUCACUCAGUUGUGAAUAGGAAGGGCUCUCUGUGAUCUGGCCACAGCUUAUUUCUUGCCACAUUCCUAUUUUCAGUCCUCUUCCAAUCAUGUGGAACUUCCAGCAUCUCCUUACACAUGCCAUGUUAUUUCACACUUUUGUGACUUUGCUCAUAUUUUUCUCUCUCCCUGGAAAGCUCCCCGACAACCUCCACUGCCAUUACCCACUAGGCAAGUACAUCCUGUUUUCAGAAUCAGCCCAAUAUCAUCUUUCCUAGGGAAUCUUGUCAGACUGCCCUUCAUUACCAACAGACAAAAUAACUACCUUAUCUUUGGUUCUGUCUUCACUCUAGACCUAUGUAGCAUGCUACUUAUAACACUGCAUUGGUUUGUUGGCAUUUGUAUUUUCCACUGAGCAACCAUAACUUAUGUGUAGACAAAAAUUGUAUUGCUCACCUUUGGAUUACUAGGACCUAGCAGUGUUCUGAUUCAGAGUAUGUACUCAAUAAAUUCAUCUUGAAAAGUGAAUGAAUGAAUAAAUGAACGCCUGCAUCUCCAUCAUUGAUUUACUAUUUAAUCAGUGAAGUUUUUAAAUUAUAUUCCCCCAUAUCUUGAGAUUUGAUCUUGUGUUAAAUCAGUUGCACAUAUUAGACAUUACUUUGUCCUUUUCACUUCUCCUUAGCACAUAUGGGCUAUAUAAUCUUUAUAAAGGUUAAAGAAAUAUAUUGUAAUAUGUUAUAACACAAUCAAGAUACAUCUGAAACAACAUAGUGCAGGCACUAUUUCCGAUGUUCAACAUCAUGCUGGAGUAAAACUUAGAGACUCUUGGAAAAAAGAAAUACUUAAAUAAUGUCACCAGUGUAAUGUGCUACAUUGUAAUGGUGUUAUGCUUAUUACAUGUGUUAUCUAGUAAUGCACAAAAAGCCUAAUGGAUUUGCUCAUAUUUUCCUCAUGUGCAAAUGAAAACACUGAGUCUCAGAGAGAUUAAAUAAAUUGCCAAAUGUCAUGUCAAGCGAUUUUGAUCCUGGUAUUUCUAAUAUAAAAGCCCAUGUUUUAAUUUAUUAACUGUUUGACAUAUAACAAUAAUAGAUCAUUACAUGUUAAUAUAAAUAACCUAUGUAUGAAGACUAAUUAUAUUUUUACUUCUGCAUUCAAUCAACUGCAACAUGUCAUUUUGGUUGAUGUGUACAGAAAAUACUCAACAUCUCGCAGAUAUUGGGUUGGAAAACAGAGGACAUUUUUAUAUCUGUUUCAGAUAAAUGUAUAUAUUUUUCUUUGAUAGUACACCAAAAUUUGACAAGUGACUAUUUCUUAAAGGGUAGUUGCAGCAUGAAAUCCAAAAUAACAUCAAUAAACUUUUCAUUCUCUGUUACACUAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications