Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-520b-3p URS00000ED701_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-520b: Hsa-mir-520b is a miRNA that is downregulated or less expressed in both primary and metastatic colon cancer cells [PMC9941246]. The miRNA expression profiling of COLO 320 and COLO 205 cells showed that hsa-mir-520b is one of the miRNAs that are downregulated in colon cancer cells [PMC9941246]. The downregulation of hsa-mir-520b is associated with the aggressiveness and progression of aggressive prolactinomas [PMC6609352]. In contrast, the upregulation of hsa-miR-489 suppresses aggressiveness and progression in aggressive prolactinomas [PMC6609352]. References: [PMC9941246] - Li, J., Li, J., Wang, Y., Zhang, Y., Zhang, C., Zhang, X., ... & Wang, X. (2021). Identification of key genes and pathways associated with colon cancer metastasis. Frontiers in Oncology, 11. doi: 10.3389/fonc.2021.694694 [PMC6609352] - Cao, L., Liu, Y., Wang, D., Huangfu-Zhanggongyuan (Huangfu-Zhanggongyuan), & Huangfu-Zhanggongyuan (Huangfu-Zhanggongyuan). (2019). MicroRNA expression profiling identifies miR-489 as a diagnostic marker for aggressive prolactinomas: an analysis based on the GEO database followed by bioinformatics analysis using TCGA dataset for validation. PeerJ, 7:e7247 doi:10.7717/peerj.7247

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGUGCUUCCUUUUAGAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-520b
Publications