Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1587 URS00000ECE90_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1587: Hsa-mir-1587 is a microRNA that has been identified as less well characterized, with a miRBase ID greater than 1000 [PMC5460954]. It has been found to be secreted through exosomes released by glioma-associated mesenchymal stem cells, and its downstream molecule NCOR1 is suppressed in glioma stem cells, leading to enhanced proliferation, colony formation, and tumor progression [PMC8509502]. Hsa-mir-1587 has been studied in terms of its interactions with proteins and it was found that CASK is a target of hsa-mir-1587 [PMC8509502]. Despite its importance, the interaction of hsa-mir-1587 with proteins has rarely been studied [PMC8509502]. Hsa-mir-1587 can fold into a G-quadruplex structure and is highly expressed in HeLa cells [PMC8509502]. It has also been identified as one of the miRNA binding sites for hsa_circ_0089172 and was found to be differentially expressed compared to the control group in a study on PCOS patients [PMC6579753] [PMC6579986]. Hsa-mir-1587 was one of the miRNAs that were ubiquitously downregulated in comparisons between resting samples from different groups compared to HIV-negative samples [PMC4865051].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGGCUGGGCUGGGUUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications