v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2237 (LINC02237) URS00000E7A69_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02237: LINC02237, a long intergenic non-protein coding RNA, has been extensively studied in the context of low-grade glioma [PMC7288909]. Zhang et al. found that the expression of LINC02237 was increased in patients with lower risk scores, while other lncRNAs, such as LINC01447 and AC106786.1, were increased in patients with higher risk scores [PMC7288909]. The study also identified a total of 10 lncRNAs significantly associated with overall survival (OS), including LINC02237 and LINC01447 [PMC7288909]. In a multivariate analysis, AC106786.1, LINC02237, and LINC01447 were included in a predictive model for OS [PMC7288909]. Additionally, the study found that high expression of AC000061.1, LINC01163, and LINC02237 predicted good prognosis after radiotherapy in terms of longer OS and progression-free survival (PFS) [PMC7288909]. Another study by Zhang et al. identified six single nucleotide polymorphisms (SNPs) associated with low-grade glioma risk, including one SNP located in the gene for LINC02237 [PMC9652902]. Furthermore, another study by Zhang et al. highlighted that AC000061.1, LINC01163, and LINC02237 were associated with good prognoses for radiotherapy in low-grade glioma patients [PMC8268860].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAAUUUCUUCUUUCCUGCCUGCUGAAGACUGACUUCCUCCUGCUGCCAAAGAUCCUCUAAACUAACUACAAGCUCCUCCACAUUAUCAGGACAAACACAAUUCUAACUCUCAAAAGUUCUAGAGUCUGGACGUCUGAGAUCAGGGUGCCAGCACUGUCGAGGUCACAGACUGCAGACCUCCUUGUAUCUUCAAAUGGAGGAAAGAGGACAAGAGAGCUCCUGUGGUCCCUUUUAUCAAGGCAUUUGCAGUGAUACAUCCUAGUGAUGGCAGCAACCGCCCGUCUGGAGCCGCGGUUGGGAAGACGUCGUCUGCAGCAAGGGAGGCGUGGUGGGGCUGUGCCUCUGUGGAGCUGGUGAGGCCGGGAACAGGCAGGCCCCCCGCCCCUAUCAAGUCGCGGGGCAAGAGCCCCUCCCUCCAGAUGCAACUGCAAGGGUGACUCCAGACCUAUACGCCCUAUGGCACUGUAGGCUCGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications