Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-208a-3p URS00000E5433_9606

mRNA interactions 8 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAAGACGAGCAAAAAGCUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Anolis carolinensis aca-miR-208-3p
  2. Bos taurus bta-miR-208a
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-208a
  4. Canis lupus familiaris (dog) cfa-miR-208a
  5. Cavia porcellus (domestic guinea pig) cpo-miR-208a-3p
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-208-P2_3p (mature (guide))
  7. Dasypus novemcinctus dno-miR-208a-3p
  8. Echinops telfairi Ete-Mir-208-P2_3p (mature (guide))
  9. Equus caballus (horse) eca-miR-208a
  10. Gekko japonicus Gja-Mir-208-P2_3p (mature (guide))
  11. Macaca mulatta (Rhesus monkey) mml-miR-208a-3p
  12. Mus musculus mmu-miR-208a-3p
  13. Ophiophagus hannah oha-miR-208-3p
  14. Ornithorhynchus anatinus oan-miR-208-3p
  15. Oryctolagus cuniculus ocu-miR-208a-3p
  16. Pan troglodytes ptr-miR-208a
  17. Pongo pygmaeus ppy-miR-208a
  18. Pteropus alecto pal-miR-208a-3p
  19. Python bivittatus (Burmese python) Pbv-Mir-208-P2_3p (mature (guide))
  20. Rattus norvegicus Rno-Mir-208-P2_3p (mature (guide))
  21. Sarcophilus harrisii Sha-Mir-208-P2_3p (mature (guide))
Publications