Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00000E463C_559292

Automated summary: This snoRNA sequence is 194 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (SGD, RefSeq, Rfam, ENA, IntAct). Described in 55 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR3, RF01251). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR3 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 6

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-11790315 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-11790372 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-12511553 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-10821992 P33322 CBF5 Centromere-binding factor 5 Centromere/microtubule-binding protein CBF5 D6VYH9 EBI-4105 H/ACA snoRNP protein CBF5 L9470.11 P33322 Small nucleolar RNP protein CBF5 YLR175W cbf5_yeast p64'
EBI-16640947 P53617 D6W0U2 EBI-12228 N0868 NRD1 P53617 YNL251C nrd1_yeast
EBI-16764048 P53617 D6W0U2 EBI-12228 N0868 NRD1 P53617 YNL251C nrd1_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACUUUGUCCUAAAGUACUAAUCCACCGCAUUAGACAGUACGAAGAUCGAGCUAUUUAUUUGAACACUCGGUCUUAUUCGUGAUAAGCGUAAUGUGGAGAGAUCAAUUUCCGGGUCAUUUAUAAGAACUCGAGUGGAUUGCUAGUUGUUUUGAUUAGCUGAAUGAGACUCGAGUGUCAGAAGAUGACUAUAUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 91 other species

    1. Marmota marmota marmota (Alpine marmot) snoRNA (ENSMMMG00000009928.1)
    2. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR3
    3. Saccharomyces cerevisiae EC1118 SNR3
    4. Saccharomyces cerevisiae P283 SNR3
    5. Saccharomyces cerevisiae P301 SNR3
    6. Saccharomyces cerevisiae PE-2 SNR3
    7. Saccharomyces cerevisiae R008 SNR3
    8. Saccharomyces cerevisiae R103 SNR3
    9. Saccharomyces cerevisiae Vin13 Small nucleolar RNA snR3
    10. Saccharomyces cerevisiae VL3 Small nucleolar RNA snR3
    11. Saccharomyces cerevisiae YJM1129 SNR3
    12. Saccharomyces cerevisiae YJM1133 SNR3
    13. Saccharomyces cerevisiae YJM1190 SNR3
    14. Saccharomyces cerevisiae YJM1199 SNR3
    15. Saccharomyces cerevisiae YJM1202 SNR3
    16. Saccharomyces cerevisiae YJM1208 SNR3
    17. Saccharomyces cerevisiae YJM1242 SNR3
    18. Saccharomyces cerevisiae YJM1244 SNR3
    19. Saccharomyces cerevisiae YJM1250 SNR3
    20. Saccharomyces cerevisiae YJM1273 SNR3
    21. Saccharomyces cerevisiae YJM1304 SNR3
    22. Saccharomyces cerevisiae YJM1307 SNR3
    23. Saccharomyces cerevisiae YJM1311 SNR3
    24. Saccharomyces cerevisiae YJM1326 SNR3
    25. Saccharomyces cerevisiae YJM1332 SNR3
    26. Saccharomyces cerevisiae YJM1336 SNR3
    27. Saccharomyces cerevisiae YJM1338 SNR3
    28. Saccharomyces cerevisiae YJM1341 SNR3
    29. Saccharomyces cerevisiae YJM1342 SNR3
    30. Saccharomyces cerevisiae YJM1356 SNR3
    31. Saccharomyces cerevisiae YJM1381 SNR3
    32. Saccharomyces cerevisiae YJM1383 SNR3
    33. Saccharomyces cerevisiae YJM1385 SNR3
    34. Saccharomyces cerevisiae YJM1386 SNR3
    35. Saccharomyces cerevisiae YJM1387 SNR3
    36. Saccharomyces cerevisiae YJM1388 SNR3
    37. Saccharomyces cerevisiae YJM1389 SNR3
    38. Saccharomyces cerevisiae YJM1400 SNR3
    39. Saccharomyces cerevisiae YJM1401 SNR3
    40. Saccharomyces cerevisiae YJM1402 SNR3
    41. Saccharomyces cerevisiae YJM1415 SNR3
    42. Saccharomyces cerevisiae YJM1417 SNR3
    43. Saccharomyces cerevisiae YJM1418 SNR3
    44. Saccharomyces cerevisiae YJM1419 SNR3
    45. Saccharomyces cerevisiae YJM1433 SNR3
    46. Saccharomyces cerevisiae YJM1434 SNR3
    47. Saccharomyces cerevisiae YJM1443 SNR3
    48. Saccharomyces cerevisiae YJM1444 SNR3
    49. Saccharomyces cerevisiae YJM1450 SNR3
    50. Saccharomyces cerevisiae YJM1460 SNR3
    51. Saccharomyces cerevisiae YJM1463 SNR3
    52. Saccharomyces cerevisiae YJM1477 SNR3
    53. Saccharomyces cerevisiae YJM1478 SNR3
    54. Saccharomyces cerevisiae YJM1479 SNR3
    55. Saccharomyces cerevisiae YJM1526 SNR3
    56. Saccharomyces cerevisiae YJM1527 SNR3
    57. Saccharomyces cerevisiae YJM1549 SNR3
    58. Saccharomyces cerevisiae YJM1573 SNR3
    59. Saccharomyces cerevisiae YJM1574 SNR3
    60. Saccharomyces cerevisiae YJM1592 SNR3
    61. Saccharomyces cerevisiae YJM1615 SNR3
    62. Saccharomyces cerevisiae YJM189 SNR3
    63. Saccharomyces cerevisiae YJM244 SNR3
    64. Saccharomyces cerevisiae YJM270 SNR3
    65. Saccharomyces cerevisiae YJM271 SNR3
    66. Saccharomyces cerevisiae YJM320 SNR3
    67. Saccharomyces cerevisiae YJM326 SNR3
    68. Saccharomyces cerevisiae YJM428 SNR3
    69. Saccharomyces cerevisiae YJM450 SNR3
    70. Saccharomyces cerevisiae YJM451 SNR3
    71. Saccharomyces cerevisiae YJM453 SNR3
    72. Saccharomyces cerevisiae YJM456 SNR3
    73. Saccharomyces cerevisiae YJM541 SNR3
    74. Saccharomyces cerevisiae YJM554 SNR3
    75. Saccharomyces cerevisiae YJM555 SNR3
    76. Saccharomyces cerevisiae YJM681 SNR3
    77. Saccharomyces cerevisiae YJM682 SNR3
    78. Saccharomyces cerevisiae YJM683 SNR3
    79. Saccharomyces cerevisiae YJM689 SNR3
    80. Saccharomyces cerevisiae YJM693 SNR3
    81. Saccharomyces cerevisiae YJM969 SNR3
    82. Saccharomyces cerevisiae YJM972 SNR3
    83. Saccharomyces cerevisiae YJM975 SNR3
    84. Saccharomyces cerevisiae YJM978 SNR3
    85. Saccharomyces cerevisiae YJM981 SNR3
    86. Saccharomyces cerevisiae YJM984 SNR3
    87. Saccharomyces cerevisiae YJM987 SNR3
    88. Saccharomyces cerevisiae YJM990 SNR3
    89. Saccharomyces cerevisiae YJM993 SNR3
    90. Saccharomyces cerevisiae YJM996 SNR3
    2D structure New