v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ZNF197 antisense RNA 1 (ZNF197-AS1) URS00000E1A0E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ZNF197-AS1: ZNF197-AS1 is a long non-coding RNA (lncRNA) that has been identified as a significant prognostic marker in various studies [PMC10047351] [PMC6601370] [PMC8283003] [PMC8158160] [PMC8554333] [PMC9716751] [PMC9531154] [PMC9213787]. It is one of the 14 lncRNAs associated with the prognosis of glioblastoma multiforme (GBM) patients in a ceRNA network study, with lower expression levels of ZNF197-AS1 being associated with a shorter lifespan in GBM patients compared to those with higher levels [PMC6601370]. ZNF197-AS1 has also been found to be associated with drug sensitivity, as its expression was positively correlated with the IC50 values of Nelarabine, ZM-336372, cyclophosphamide, and dexamethasone Decadron in cancer cells [PMC8283003]. In addition, ZNF197-AS1 has been identified as one of the m6A-related prognostic lncRNAs associated with breast cancer (BRCA), and its expression was found to be downregulated in BRCA samples compared to normal breast samples [PMC8554333]. Furthermore, ZNF197-AS1 has been shown to be affected by hsa-miR-92a-1-5p and can influence the expression of BCAR1 through competitive combination in breast cancer cells [PMC8158160]. Overall, these studies highlight the potential role of ZNF197-AS1 as a prognostic marker and its involvement in drug sensitivity and molecular interactions in various cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAGUUGGACAUUUCUAUUUUGAUUUGCAUUUCAAUUGAGGUUGAUAGGGAGUGACCUUCACGUCUGAAUGACCUGCAGAUGAGAACAGAAUAGACUUGAUUAUGAAGCAAGAAAUUUUUAAAGGAUUUAUCUGAUGGAACAUCAAGAGGAUUCUUUCUUUCUUUUAAGAGAUAUGAGGUCUCACUCUGUCAUAGUGGCACAAUCAUAGCUCAGUGCAGCCUUGAACUCCUGGGCUCCAGCGAUCCUCCUGCCUCAGCCUCCCAAGCAGCUGGGACUACAGAUGAAUACCAUCAUGCCCCCAGCUAGUAAGAGGGUUCUAUGUGUUGAUUCACUGGGAAACCAGAGACUAGAGAUACCUGUGAAGACACUUUCAAGAAGUUAGAAGAAUUACCCUUGAAUGAAGAAAGGAGCUGACUAGAAGUAGUUUAUUGAAUAACACACAAAGAUUGUUUCAAACCUACAAAAGAUAAAUGUGAGGAAGGGAUUUGGGGAAUCCUCCUAUGUCCUCCAGUCUGGCUAUACAUUAGGAUGGAACAGAAAUCCUACCAAUGUGAUGAAUGUGGCAAAGCUUUCAGAGUGCAUACCUCAAUGGCCAUCAGAAAACCUAUACUGGAGUGAAACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications