Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae YJM1242 SNR71 URS00000E08CC_1294338

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUAUAUGAUGAUAACCUUCUCAGCUCACUCAGAUCUUUUGAUAUGAUUGAUAAAAAUUUCCUAUCCAACAUUCAUCAAUUUAUCUGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 200 other species

  1. Saccharomyces cerevisiae Small nucleolar RNA snR71
  2. Saccharomyces cerevisiae EC1118 SNR71
  3. Saccharomyces cerevisiae Kyokai no. 7 K7_snR71
  4. Saccharomyces cerevisiae P283 SNR71
  5. Saccharomyces cerevisiae P301 SNR71
  6. Saccharomyces cerevisiae PE-2 SNR71
  7. Saccharomyces cerevisiae R008 SNR71
  8. Saccharomyces cerevisiae R103 SNR71
  9. Saccharomyces cerevisiae S288C Small Nucleolar RNA
  10. Saccharomyces cerevisiae YJM1078 SNR71
  11. Saccharomyces cerevisiae YJM1083 SNR71
  12. Saccharomyces cerevisiae YJM1129 SNR71
  13. Saccharomyces cerevisiae YJM1133 SNR71
  14. Saccharomyces cerevisiae YJM1190 SNR71
  15. Saccharomyces cerevisiae YJM1199 SNR71
  16. Saccharomyces cerevisiae YJM1202 SNR71
  17. Saccharomyces cerevisiae YJM1208 SNR71
  18. Saccharomyces cerevisiae YJM1244 SNR71
  19. Saccharomyces cerevisiae YJM1248 SNR71
  20. Saccharomyces cerevisiae YJM1250 SNR71
  21. Saccharomyces cerevisiae YJM1252 SNR71
  22. Saccharomyces cerevisiae YJM1273 SNR71
  23. Saccharomyces cerevisiae YJM1304 SNR71
  24. Saccharomyces cerevisiae YJM1307 SNR71
  25. Saccharomyces cerevisiae YJM1311 SNR71
  26. Saccharomyces cerevisiae YJM1326 SNR71
  27. Saccharomyces cerevisiae YJM1332 SNR71
  28. Saccharomyces cerevisiae YJM1336 SNR71
  29. Saccharomyces cerevisiae YJM1338 SNR71
  30. Saccharomyces cerevisiae YJM1341 SNR71
  31. Saccharomyces cerevisiae YJM1342 SNR71
  32. Saccharomyces cerevisiae YJM1355 SNR71
  33. Saccharomyces cerevisiae YJM1356 SNR71
  34. Saccharomyces cerevisiae YJM1381 SNR71
  35. Saccharomyces cerevisiae YJM1383 SNR71
  36. Saccharomyces cerevisiae YJM1385 SNR71
  37. Saccharomyces cerevisiae YJM1386 SNR71
  38. Saccharomyces cerevisiae YJM1387 SNR71
  39. Saccharomyces cerevisiae YJM1388 SNR71
  40. Saccharomyces cerevisiae YJM1389 SNR71
  41. Saccharomyces cerevisiae YJM1399 SNR71
  42. Saccharomyces cerevisiae YJM1400 SNR71
  43. Saccharomyces cerevisiae YJM1401 SNR71
  44. Saccharomyces cerevisiae YJM1402 SNR71
  45. Saccharomyces cerevisiae YJM1415 SNR71
  46. Saccharomyces cerevisiae YJM1417 SNR71
  47. Saccharomyces cerevisiae YJM1418 SNR71
  48. Saccharomyces cerevisiae YJM1419 SNR71
  49. Saccharomyces cerevisiae YJM1433 SNR71
  50. Saccharomyces cerevisiae YJM1434 SNR71
  51. Saccharomyces cerevisiae YJM1439 SNR71
  52. Saccharomyces cerevisiae YJM1443 SNR71
  53. Saccharomyces cerevisiae YJM1444 SNR71
  54. Saccharomyces cerevisiae YJM1447 SNR71
  55. Saccharomyces cerevisiae YJM1450 SNR71
  56. Saccharomyces cerevisiae YJM1460 SNR71
  57. Saccharomyces cerevisiae YJM1463 SNR71
  58. Saccharomyces cerevisiae YJM1477 SNR71
  59. Saccharomyces cerevisiae YJM1478 SNR71
  60. Saccharomyces cerevisiae YJM1479 SNR71
  61. Saccharomyces cerevisiae YJM1526 SNR71
  62. Saccharomyces cerevisiae YJM1527 SNR71
  63. Saccharomyces cerevisiae YJM1573 SNR71
  64. Saccharomyces cerevisiae YJM1574 SNR71
  65. Saccharomyces cerevisiae YJM1592 SNR71
  66. Saccharomyces cerevisiae YJM1615 SNR71
  67. Saccharomyces cerevisiae YJM189 SNR71
  68. Saccharomyces cerevisiae YJM193 SNR71
  69. Saccharomyces cerevisiae YJM195 SNR71
  70. Saccharomyces cerevisiae YJM244 SNR71
  71. Saccharomyces cerevisiae YJM248 SNR71
  72. Saccharomyces cerevisiae YJM270 SNR71
  73. Saccharomyces cerevisiae YJM271 SNR71
  74. Saccharomyces cerevisiae YJM320 SNR71
  75. Saccharomyces cerevisiae YJM326 SNR71
  76. Saccharomyces cerevisiae YJM428 SNR71
  77. Saccharomyces cerevisiae YJM450 SNR71
  78. Saccharomyces cerevisiae YJM451 SNR71
  79. Saccharomyces cerevisiae YJM453 SNR71
  80. Saccharomyces cerevisiae YJM456 SNR71
  81. Saccharomyces cerevisiae YJM470 SNR71
  82. Saccharomyces cerevisiae YJM541 SNR71
  83. Saccharomyces cerevisiae YJM554 SNR71
  84. Saccharomyces cerevisiae YJM555 SNR71
  85. Saccharomyces cerevisiae YJM627 SNR71
  86. Saccharomyces cerevisiae YJM681 SNR71
  87. Saccharomyces cerevisiae YJM682 SNR71
  88. Saccharomyces cerevisiae YJM683 SNR71
  89. Saccharomyces cerevisiae YJM689 SNR71
  90. Saccharomyces cerevisiae YJM693 SNR71
  91. Saccharomyces cerevisiae YJM969 SNR71
  92. Saccharomyces cerevisiae YJM972 SNR71
  93. Saccharomyces cerevisiae YJM975 SNR71
  94. Saccharomyces cerevisiae YJM978 SNR71
  95. Saccharomyces cerevisiae YJM981 SNR71
  96. Saccharomyces cerevisiae YJM984 SNR71
  97. Saccharomyces cerevisiae YJM987 SNR71
  98. Saccharomyces cerevisiae YJM990 SNR71
  99. Saccharomyces cerevisiae YJM993 SNR71
  100. Saccharomyces cerevisiae YJM996 SNR71