v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Oceanimonas sp. GK1 5S ribosomal RNA secondary structure diagram

Oceanimonas sp. GK1 5S ribosomal RNA URS00000DB60F_511062

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCUGGCGGCCAUAGCGUUGUGGAACCACCUGAUUCCAUGCCGAACUCAGCAGUGAAACGCAACCGCGCCGAUGAUAGUGUGGCAGCUGCCAUGUGAAAGUAGGUCACUGCCAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Oceanimonas pelagia 5S ribosomal RNA
  2. Oceanimonas sp. CAM02 5S ribosomal RNA
  3. Oceanimonas sp. CHS3-5 5S ribosomal RNA
 2D structure Publications