Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Methanosphaera stadtmanae DSM 3091 16S ribosomal RNA secondary structure diagram

Methanosphaera stadtmanae DSM 3091 16S ribosomal RNA URS00000DB042_339860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCAGUAACACGUGGAUAACUUACCCUUAGGACCGGGAUAACUUUGGGAAACUGAAGAUAAUACUGGAUAUUAGGUUAUGCCUGGAAUGGUUUACCUUUGAAAUGUAUUUUUCGCCUAAGGAUAGAUCUGCGGCUGAUUAGGUCGUUGGUGGGGUAAUGGCCCACCAAGCCGAUGAUCGGUACGGGUUGUGAGAGCAAGAGCCCGGAGAUGGAACCUGAGACAAGGUUCCAGACCCUACGGGGUGCAGCAGGCGCGAAACCUCCGCAAUGUACGCAAGUGCGACGGGGGGAUCCCAAGUGUUAUUCUUAACAGAAUAACUUUUCAUUAGUGUAAAAAGCUUUUAGAAUAAGAGCUGGGCAAGACCGGUGCCAGCCGCCGCGGUAACACCGGCAGCUCAAGUGGUAGCUGUUUUUAUUGGGCCUAAAGCGUUCGUAGCCGGUUUGAUAAGUCUUUGGUGAAAGCUUGUAGCUUAACUAUAAGAAUUGCUGAAGAUACUGUCAGACUUGAAGUCGGGAGAGGUUAGAGGUACUACCGGGGUAGGGGUGAAAUCCUAUAAUCCUGGGAGGACCACCUGUGGCGAAGGCGUCUAACUGGAACGAUCUUGACGGUGAGUAACGAAAGCCAGGGGCGCGAACCGGAUUAGAUACCCGGGUAGUCCUGGCCGUAAACGAUGUGGACUUGGUGUUGGAAUGGCCUCGAGUUGUUCCGGUGCCGAAGGGAAGCUGUUAAGUCCACCGCCUGGGAAGUACGGUCGCAAGACUGAAACUUAAAGGAAUUGGCGGGGGAGCACCACAACGCGUGGAGCCUGCGGUUUAAUUGGAUUCAACGCCGGACAUCUCACCAGGAGCGACAGCAGAAUGAUAAUCAGGUUGAUGACCUUAUUUGACUAGCUGAGAGGAGGUGCAUGGCCGCCGUCAGCUCGUACUGUGAAGCGUCCUGUUAAGUCAGGCAACGAGCGAGACCCACGCCCUUAGUUACCAACACAAUCUCUGGAUUGGUGGGCACACUAGGGGGACCGCCAGUGAUAAACUGGAGGAAGGAGUGGACGACGGUAGGUCCGUAUGCCCCGAAUCUCCUGGGCUACACGCGGGCUACAAUGGCUAUGGCAAUGGGUUUCUGCACUGAAAAGUGAUGGUAAUCUCCUAAACAUAGUCUUAGUUCGGAUUGAGGGCUGUAACUCGCCCUCAUGAAGCUGGAAUGCGUAGUAAUCGCAUGUCACAACCGUGCGGUGAAUACGUCCCUGCUCCUUGCACACACCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Methanosphaera stadtmanae bacterial SSU rRNA
  2. uncultured methanogenic archaeon bacterial SSU rRNA
  3. unidentified bacterial SSU rRNA
2D structure