Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00000DA860_559292

  • 99 nucleotides
  • 5 databases (ENA, IntAct, RefSeq, Rfam, SGD)
  • Found in 105 species

Automated summary: This snoRNA sequence is 99 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (RefSeq, Rfam, ENA, IntAct, SGD). Described in 47 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR47, RF01203). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR47 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 3

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

IntAct ID Participant Synonyms
EBI-11792815 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast
EBI-15097617 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast
EBI-11792824 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUAUAUGAUGAUAUCCUAUAACAACAACAACAUGAAUUUCUUCGUCCGAAUCCUUUAUAGGUGGAAACAAACUUUGACAAUAGCUUUUUAACACUGAUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 104 other species

    1. Saccharomyces cerevisiae AWRI796 Small nucleolar RNA snR47
    2. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR47
    3. Saccharomyces cerevisiae EC1118 SNR47
    4. Saccharomyces cerevisiae FostersB Small nucleolar RNA snR47
    5. Saccharomyces cerevisiae FostersO Small nucleolar RNA snR47
    6. Saccharomyces cerevisiae Lalvin QA23 Small nucleolar RNA snR47
    7. Saccharomyces cerevisiae P301 SNR47
    8. Saccharomyces cerevisiae PE-2 SNR47
    9. Saccharomyces cerevisiae R008 SNR47
    10. Saccharomyces cerevisiae R103 SNR47
    11. Saccharomyces cerevisiae Vin13 Small nucleolar RNA snR47
    12. Saccharomyces cerevisiae VL3 Small nucleolar RNA snR47
    13. Saccharomyces cerevisiae YJM1078 SNR47
    14. Saccharomyces cerevisiae YJM1083 SNR47
    15. Saccharomyces cerevisiae YJM1129 SNR47
    16. Saccharomyces cerevisiae YJM1133 SNR47
    17. Saccharomyces cerevisiae YJM1190 SNR47
    18. Saccharomyces cerevisiae YJM1199 SNR47
    19. Saccharomyces cerevisiae YJM1202 SNR47
    20. Saccharomyces cerevisiae YJM1208 SNR47
    21. Saccharomyces cerevisiae YJM1242 SNR47
    22. Saccharomyces cerevisiae YJM1244 SNR47
    23. Saccharomyces cerevisiae YJM1248 SNR47
    24. Saccharomyces cerevisiae YJM1250 SNR47
    25. Saccharomyces cerevisiae YJM1252 SNR47
    26. Saccharomyces cerevisiae YJM1273 SNR47
    27. Saccharomyces cerevisiae YJM1304 SNR47
    28. Saccharomyces cerevisiae YJM1307 SNR47
    29. Saccharomyces cerevisiae YJM1311 SNR47
    30. Saccharomyces cerevisiae YJM1326 SNR47
    31. Saccharomyces cerevisiae YJM1332 SNR47
    32. Saccharomyces cerevisiae YJM1336 SNR47
    33. Saccharomyces cerevisiae YJM1338 SNR47
    34. Saccharomyces cerevisiae YJM1341 SNR47
    35. Saccharomyces cerevisiae YJM1342 SNR47
    36. Saccharomyces cerevisiae YJM1355 SNR47
    37. Saccharomyces cerevisiae YJM1356 SNR47
    38. Saccharomyces cerevisiae YJM1381 SNR47
    39. Saccharomyces cerevisiae YJM1383 SNR47
    40. Saccharomyces cerevisiae YJM1385 SNR47
    41. Saccharomyces cerevisiae YJM1386 SNR47
    42. Saccharomyces cerevisiae YJM1387 SNR47
    43. Saccharomyces cerevisiae YJM1388 SNR47
    44. Saccharomyces cerevisiae YJM1389 SNR47
    45. Saccharomyces cerevisiae YJM1399 SNR47
    46. Saccharomyces cerevisiae YJM1400 SNR47
    47. Saccharomyces cerevisiae YJM1401 SNR47
    48. Saccharomyces cerevisiae YJM1402 SNR47
    49. Saccharomyces cerevisiae YJM1415 SNR47
    50. Saccharomyces cerevisiae YJM1417 SNR47
    51. Saccharomyces cerevisiae YJM1418 SNR47
    52. Saccharomyces cerevisiae YJM1419 SNR47
    53. Saccharomyces cerevisiae YJM1433 SNR47
    54. Saccharomyces cerevisiae YJM1434 SNR47
    55. Saccharomyces cerevisiae YJM1439 SNR47
    56. Saccharomyces cerevisiae YJM1443 SNR47
    57. Saccharomyces cerevisiae YJM1444 SNR47
    58. Saccharomyces cerevisiae YJM1447 SNR47
    59. Saccharomyces cerevisiae YJM1450 SNR47
    60. Saccharomyces cerevisiae YJM1460 SNR47
    61. Saccharomyces cerevisiae YJM1463 SNR47
    62. Saccharomyces cerevisiae YJM1477 SNR47
    63. Saccharomyces cerevisiae YJM1478 SNR47
    64. Saccharomyces cerevisiae YJM1479 SNR47
    65. Saccharomyces cerevisiae YJM1526 SNR47
    66. Saccharomyces cerevisiae YJM1527 SNR47
    67. Saccharomyces cerevisiae YJM1549 SNR47
    68. Saccharomyces cerevisiae YJM1573 SNR47
    69. Saccharomyces cerevisiae YJM1574 SNR47
    70. Saccharomyces cerevisiae YJM1592 SNR47
    71. Saccharomyces cerevisiae YJM1615 SNR47
    72. Saccharomyces cerevisiae YJM189 SNR47
    73. Saccharomyces cerevisiae YJM193 SNR47
    74. Saccharomyces cerevisiae YJM195 SNR47
    75. Saccharomyces cerevisiae YJM244 SNR47
    76. Saccharomyces cerevisiae YJM248 SNR47
    77. Saccharomyces cerevisiae YJM270 SNR47
    78. Saccharomyces cerevisiae YJM271 SNR47
    79. Saccharomyces cerevisiae YJM320 SNR47
    80. Saccharomyces cerevisiae YJM326 SNR47
    81. Saccharomyces cerevisiae YJM428 SNR47
    82. Saccharomyces cerevisiae YJM450 SNR47
    83. Saccharomyces cerevisiae YJM451 SNR47
    84. Saccharomyces cerevisiae YJM453 SNR47
    85. Saccharomyces cerevisiae YJM456 SNR47
    86. Saccharomyces cerevisiae YJM470 SNR47
    87. Saccharomyces cerevisiae YJM541 SNR47
    88. Saccharomyces cerevisiae YJM554 SNR47
    89. Saccharomyces cerevisiae YJM555 SNR47
    90. Saccharomyces cerevisiae YJM627 SNR47
    91. Saccharomyces cerevisiae YJM681 SNR47
    92. Saccharomyces cerevisiae YJM682 SNR47
    93. Saccharomyces cerevisiae YJM683 SNR47
    94. Saccharomyces cerevisiae YJM689 SNR47
    95. Saccharomyces cerevisiae YJM693 SNR47
    96. Saccharomyces cerevisiae YJM969 SNR47
    97. Saccharomyces cerevisiae YJM972 SNR47
    98. Saccharomyces cerevisiae YJM975 SNR47
    99. Saccharomyces cerevisiae YJM978 SNR47
    100. Saccharomyces cerevisiae YJM981 SNR47
    101. Saccharomyces cerevisiae YJM984 SNR47
    102. Saccharomyces cerevisiae YJM987 SNR47
    103. Saccharomyces cerevisiae YJM990 SNR47
    104. Saccharomyces cerevisiae YJM993 SNR47
    105. Saccharomyces cerevisiae YJM996 SNR47
    2D structure New