Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-196a precursor (hsa-mir-196a-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-196a precursor (hsa-mir-196a-2) URS00000D6378_9606

  • 110 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 29 species

Automated summary: This pre miRNA sequence is 110 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (RefSeq, miRBase, HGNC, MalaCards, Ensembl/GENCODE, ENA, GeneCards, Ensembl). Described in 53 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-196, RF00256). Homo sapiens (human) microRNA hsa-mir-196a precursor (hsa-mir-196a-2) sequence is a product of mir-196a-2 precursor, mir-196a-2, mir-196a-2 precurso, hsa-mir-196a-2 precursor, MIR196A2 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGCUCGCUCAGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUUGGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUACAUCAGUCGGUUUUCGUCGAGGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Canis lupus dingo microRNA 196a-2
    2. Canis lupus familiaris microRNA 196a-2
    3. Carlito syrichta (Philippine tarsier) miRNA
    4. Dasypus novemcinctus (nine-banded armadillo) microRNA 196a-2
    5. Equus asinus asinus (donkey) microRNA 196a-2
    6. Equus caballus (horse) miRNA
    7. Felis catus (domestic cat) miRNA
    8. Gorilla gorilla microRNA ggo-mir-196 precursor (ggo-mir-196-2)
    9. Lynx canadensis (Canada lynx) microRNA 196a-2
    10. Macaca fascicularis miRNA
    11. Macaca mulatta microRNA mml-mir-196a precursor (mml-mir-196a-2)
    12. Macaca nemestrina miRNA
    13. Mandrillus leucophaeus (Drill) miRNA
    14. Mustela putorius furo (Domestic ferret) microRNA 196a-2
    15. Neovison vison microRNA 196a-2
    16. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 196a-2 (MIR196A2)
    17. Otolemur garnettii (small-eared galago) miRNA
    18. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-196 precursor
    19. Panthera leo (lion) microRNA 196a-2
    20. Panthera pardus microRNA 196a-2
    21. Panthera tigris altaica (Tiger) microRNA 196a-2
    22. Pan troglodytes (chimpanzee) microRNA ptr-mir-196a precursor (ptr-mir-196a-2)
    23. Papio anubis (Olive baboon) miRNA
    24. Pongo abelii microRNA 196a-2
    25. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-196 precursor (ppy-mir-196-2)
    26. Suricata suricatta (meerkat) microRNA 196a-2
    27. Theropithecus gelada microRNA 196a-2
    28. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 196a-2
    29. Vulpes vulpes microRNA 196a-2
    2D structure New