Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) microRNA ptr-mir-196a precursor (ptr-mir-196a-2) URS00000D6378_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUCGCUCAGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUUGGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUACAUCAGUCGGUUUUCGUCGAGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 59 other species

  1. Canis lupus dingo microRNA 196a-2 (ENSCAFG00020020656.1)
  2. Canis lupus familiaris (dog) miRNA (ENSCAFG00000020562.2, ENSCAFG00030018942.1, ENSCAFG00040020368.1, ENSCAFG00845018320.1)
  3. Carlito syrichta (Philippine tarsier) microRNA 196a-2 (ENSTSYG00000029728.1)
  4. Dasypus novemcinctus (nine-banded armadillo) microRNA 196a-2 (ENSDNOG00000028210.1)
  5. Equus asinus asinus microRNA 196a-2 (ENSEASG00005010144.1)
  6. Equus asinus microRNA 196a-2 (ENSEASG00005010144.2)
  7. Equus caballus microRNA 196a-2 (ENSECAG00000026361.2)
  8. Felis catus (domestic cat) microRNA 196a-2 (ENSFCAG00000021927.3)
  9. Gorilla gorilla gorilla microRNA mir-196-2 (MIR196-2)
  10. Gorilla gorilla (western gorilla) microRNA ggo-mir-196 precursor (ggo-mir-196-2)
  11. Homo sapiens (human) microRNA hsa-mir-196a precursor (hsa-mir-196a-2)
  12. Lynx canadensis (Canada lynx) microRNA 196a-2 (ENSLCNG00005007196.1)
  13. Macaca fascicularis (Crab-eating macaque) microRNA 196a-2 (ENSMFAG00000004428.2)
  14. Macaca mulatta (Rhesus monkey) microRNA mml-mir-196a precursor (mml-mir-196a-2)
  15. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000016982.1)
  16. Mandrillus leucophaeus microRNA 196a-2 (ENSMLEG00000009645.1)
  17. Mustela putorius furo (Domestic ferret) microRNA 196a-2 (ENSMPUG00000021968.1)
  18. Neogale vison (American mink) microRNA 196a-2 (ENSNVIG00000002301.1)
  19. Nomascus leucogenys microRNA 196a-2 (ENSNLEG00000024124.2)
  20. Otolemur garnettii microRNA 196a-2 (ENSOGAG00000017341.1)
  21. Pan paniscus microRNA ppa-mir-196 precursor
  22. Panthera leo (lion) microRNA 196a-2 (ENSPLOG00000004831.1)
  23. Panthera pardus microRNA 196a-2 (ENSPPRG00000014391.1)
  24. Panthera tigris altaica (Tiger) microRNA 196a-2 (ENSPTIG00000001869.1)
  25. Papio anubis (olive baboon) microRNA 196a-2 (ENSPANG00000000744.3)
  26. Pongo abelii microRNA 196a-2 (ENSPPYG00000022081.2)
  27. Pongo pygmaeus microRNA ppy-mir-196 precursor (ppy-mir-196-2)
  28. Suricata suricatta (meerkat) microRNA 196a-2 (ENSSSUG00005010021.1)
  29. Theropithecus gelada (gelada) microRNA 196a-2 (ENSTGEG00000009762.1)
  30. Ursus thibetanus thibetanus microRNA 196a-2 (ENSUTTG00000003150.1)
  31. Vulpes vulpes (red fox) microRNA 196a-2 (ENSVVUG00000028198.1)
Publications