Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apis mellifera (honey bee) ame-miR-279d-3p URS00000D08A0_7460

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACUAGAUCCACACUCAUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Blattella germanica Bge-Mir-279-o36_3p (mature (guide))
  2. Centruroides sculpturatus (bark scorpion) Csc-Mir-279-P14b_3p (mature (guide))
  3. Daphnia magna Dma-Mir-279-o6_3p (mature (guide))
  4. Daphnia pulex dpu-miR-279a
  5. Dinoponera quadriceps dqu-miR-279b-3p
  6. Eisenia fetida Efe-Mir-279-o18_3p (mature (guide))
  7. Heliconius melpomene hme-miR-279a
  8. Ixodes ricinus (castor bean tick) iri-miR-279a-3p
  9. Ixodes scapularis isc-miR-279
  10. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-279-P10_3p (mature (guide))
  11. Lottia gigantea (owl limpet) lgi-miR-279
  12. Manduca sexta (tobacco hornworm) mse-miR-279a
  13. Melibe leonina mle-miR-279-3p
  14. Parasteatoda tepidariorum (common house spider) pte-miR-279-3p
  15. Penaeus japonicus miR-279
  16. Tribolium castaneum tca-miR-279b-3p
  17. Triops cancriformis tcf-miR-279a
Publications