Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-27a-3p URS00000CCB2D_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-27a: Bta-mir-27a is a microRNA (miRNA) that has been identified as one of the eight miRNAs with functions related to mastitis, based on analysis of the RNA-Seq dataset GSE75379 [PMC8928958]. Among the differentially expressed (DE) miRNAs, bta-mir-27a is found to suppress the PSTPIP2 and VAV1 genes [PMC8928958]. Additionally, bta-mir-27a has been found to have nearly equal number of sequence reads originating from both the 5′ and 3′ arms of the miRNA hairpin precursor [PMC2713767]. Bta-mir-27a belongs to the miR-27 family, which also includes bta-miR-27b [PMC3589390]. It is worth noting that fhe-miR-2b-A and fhe-miR-2a-B are orthologs of bta-mir-27a and bta-mir-27b [PMC9861972]. Bta-mir-27a has variable abundance levels during placental development and is associated with trophoblastic differentiation and vascularization [PMC5662615]. Furthermore, both fhe-miR-2b-A and fhe-miR-2a-B have similarities with bta-mir-27a in terms of targeting specific regions in myostatin and insulin growth factor (IGF) genes in cattle and humans [PMC5390025]. References: [PMC8928958] - https://pubmed.ncbi.nlm.nih.gov/33708179/ [PMC2713767] - https://pubmed.ncbi.nlm.nih.gov/21460147/ [PMC3589390] - https://pubmed.ncbi.nlm.nih.gov/23533145/ [PMC9861972] - https://pubmed.ncbi.nlm.nih.gov/34616706/ [PMC5662615] - https://pubmed.ncbi.nlm.nih.gov/28916706/ [PMC5390025] - https://pubmed.ncbi.nlm.nih.gov/28235882/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACAGUGGCUAAGUUCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Canis lupus familiaris (dog) cfa-miR-27a
  2. Capra hircus (goat) chi-miR-27a-3p
  3. Chiloscyllium plagiosum microRNA cpl-miR-27d-3p
  4. Gadus morhua gmo-miR-27d-3p
  5. Mus musculus Mus_musculus piRNA piR-mmu-8319572
  6. Oryzias latipes (Japanese medaka) ola-miR-27a
  7. Otolemur garnettii oga-miR-27a
  8. Ovis aries microRNA miR-27a
  9. Pteropus alecto pal-miR-27a-3p
  10. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62965
  11. Xenopus laevis xla-miR-27a-3p
Publications