v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62965 URS00000CCB2D_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCACAGUGGCUAAGUUCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus (cattle) bta-miR-27a-3p
  2. Canis lupus familiaris (dog) cfa-miR-27a
  3. Capra hircus (goat) chi-miR-27a-3p
  4. Chiloscyllium plagiosum microRNA cpl-miR-27d-3p
  5. Gadus morhua gmo-miR-27d-3p
  6. Mus musculus Mus_musculus piRNA piR-mmu-8319572
  7. Oryzias latipes (Japanese medaka) ola-miR-27a
  8. Otolemur garnettii oga-miR-27a
  9. Ovis aries microRNA miR-27a
  10. Pteropus alecto pal-miR-27a-3p
  11. Xenopus laevis xla-miR-27a-3p